Site Loader

LOCATION

510 5th Ave, New York, NY 10036, USA

The blast (basic local alignment search tool) explanation is been reported here
Firstly, I am going to explain about BLAST (Basic Local Alignment Search Tool) .It discovers districts of neighbourhood likeness between successions. The program looks at nucleotide or protein 10arrangements to grouping databases and computes the measurable criticalness of matches. Impact can be applied to derive practical and developmental connections between groupings and help distinguish individuals from quality families.

I have chosen nucleotide blast to find out the nucleotide database from the given genomic query. Inserted the particular sequence in BLAST tool and select proper details to blast the query. I found that cholera is the infection to the patient, caused by vibrio cholerae bacterium.

Figure :1V. cholerae is Gram-negative and comma-formed. Beginning disengages are somewhat bended, while they can show up as straight bars upon research facility refined. The bacterium has a flagellum at one cell shaft and pili. V. cholerae is a facultative anaerobe, and can experience respiratory and fermentative digestion. For the most part, it transmitted by the eating food, drinking water that contains as of now this microscopic organisms and faeces of a contaminated individual. This microbes scopes to digestive tract, inserts itself in the villi of absorptive intestinal cells and discharge cholera poison. This CT incorporate incitement of mucosal covering of digestive tract to discharge liquids. It causes loose bowels and heaving which brings about outrageous parchedness and if not treated demise.

For the first alignment of Vibrio cholerae strain (Accession Number KR072210.1) results are Max score is 776, Total score776, Query covers 100%, and E value 0.0, Ident is 100%.

Here also I took nucleotide blast tool to analysed the given allele sequences. Placed the individual alleles in a nucleotide blast and selected human genomic +transcript then run blast. Pick out the homosapiens CFTR alignment (accession number is NM-000492.3).click on gene for other information.in this way I collected details about all alleles (Husband, wife and son).

Figure:2
Figure:3
Figure:4
Figure:5TABLE 2:
Alleles Sequence name Gene name Accession number Chromosomal location size Exon count
Male allele 1 Human genomic+transcriptCFTR NM_000492.3 117,479,963..117,668,665 313bp 27
Male allele2
Human genomic+transcriptCFTR NM_000492.3 117,479,963..117,668,665 391bp 27
Female allele1 Human genomic+transcriptCFTR NM_000492.3 117,479,963..117,668,665 544bp 27
Female allele2 Human genomic+transcriptCFTR NM_000492.3 117,479,963..117,668,665 544bp 27
Sonallele1 Human genomic+transcriptCFTR NM_000492.3 117,479,963..117,668,665 544bp 27
Son allele 2 Human genomic +transcript CFTR NM_000492.3 117,479,963..117,668,665 544bp 27
Database Human genomic+transcriptCFTR NM_000492.3 117,479,963..117,668,665 544bp 27
I observed that male allele 1 and 2 has different size compare to other sequences.

Sequence Alignment
CLUSTAL 2.0.12 multiple sequence alignment female_allele_2      AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCG database_            AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCG female_allele_1      AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCG son_allele_2         AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCG male_allele_1        AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCG male_allele2         AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCGTAAACTCATTAATGCCCTTCGGCG son_allele_1         AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCGTAAACTCATTAATGCCCTTCGGCG                      *********************************** ************************ female_allele_2      ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAA database_            ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAA female_allele_1      ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAA son_allele_2         ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAA male_allele_1        ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAA male_allele2         ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAA son_allele_1         ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAA                      ************************************************************ female_allele_2      AGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGA database_            AGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGA female_allele_1      AGCAGTACAGCCTCTCTAACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGA son_allele_2         AGCAGTACAGCCTCTCTAACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGA male_allele_1        AGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGA male_allele2         AGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGA son_allele_1         AGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGA                      ***************** ****************************************** female_allele_2      GGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGAC database_            GGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGAC female_allele_1      GGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGAC son_allele_2         GGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGAC male_allele_1        GGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGAC male_allele2         GGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGAC son_allele_1         GGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGAC                      ************************************************************ female_allele_2      ACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGC database_            ACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGC female_allele_1      ACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGC son_allele_2         ACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGC male_allele_1        ACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGC male_allele2         ACTGCTCCTACACCCAGCCATTTTTGACCTTCATCACATTGGAATGCAGATGAGAATAGC son_allele_1        CCTTCATCACATTGGAATGCAGATGAGAATAGC                      ************************** ********************************* female_allele_2      TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAAT database_            TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAAT female_allele_1      TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAAT son_allele_2         TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAAT male_allele_1        TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAAT male_allele2         TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAAT son_allele_1         TATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAAT                      ************************************************************ female_allele_2      AAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACT database_            AAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACT female_allele_1      AAGTATTGGACAACTTGTTAGTCTCCATTCCAACAACCTGAACAAATTTGATGAAGGACT son_allele_2         AAGTATTGGACAACTTGTTAGTCTCCATTCCAACAACCTGAACAAATTTGATGAAGGACT male_allele_1        AAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACT male_allele2         AAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACT son_allele_1         AAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACT                      ************************** ********************************* female_allele_2      TGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAAT database_            TGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAAT female_allele_1      TGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAAT son_allele_2         TGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAAT male_allele_1        TGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAAT male_allele2         TGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAAT son_allele_1         TGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAAT                      ************************************************************ female_allele_2      CTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCT database_            CTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCT female_allele_1      CTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCT son_allele_2         CTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCT male_allele_1        CTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCT male_allele2         CTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCT son_allele_1         CTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCT                      ************************************************************ female_allele_2      TTTT database_            TTTT female_allele_1      TTTT son_allele_2         TTTT male_allele_1        TTTT male_allele2         TTTT son_allele_1         TTTT                      **** 
Figure: 6I used just bio aligner to identify the mutations in the given sequences. I have place all alleles in just bio aligner to individually to get the appropriate result and submit it.Multiple sequence alignment, which was in figure: 6
I observed that silent mutations and missense mutations are occurs in given results.
Silent mutations:
1. There is a silent mutation at 36th position of the male allele 2, son allele1 of sequences. That means presence of guanine from cytosine. Triplet codon TCC changed to TCG, which encoded with same amino acid like serine.
2. In addition, female allele one and son allele 2 has adenine instead of thymine at 138th position of arrangements. CTT converts into CTA that comes under leucine. 3. Again, adenine is present in its place of thymine at 387th position of both female allele 1 and son allele 2, which has the deviated triplet codon from CCT to CCA encoded with proline.

Silent point transformations can change how the cell perceives exons and introns. Exons are the valuable, coding parts of a quality, while introns are non-coding rubbish DNA found among the exons. Prior to a protein can be integrated, the cell hardware must find and expel the introns from the mRNA.They can cause mistakes in the intron-seeking process, making the protein be deciphered in accurately.

Another way a mutation transformation can cause an issue is by influencing the mRNA’s shape.as a rule,mRNA folds into a specific shape because of collaborations of its constituent bases.This shape influences the speed of interpretation and additionally the rate at which the cell apparatus corrupts it.A quiet transformation can change the way mRNA folds, prompting the creation of excessively or too little of the encoded protein.

Missense mutations:
At 287th, position of male allele 2and son allele 1 has a deviation from TGG to TGA that means TGG encoded with tryptophan whereas TGA is a stop codon.

Male allele 1:
E W D R E L A S K K N P K L I N A L R R C F F W R F M F Y G I F L Y L G E V T K A V Q P L L L G R I I A S Y D P D N K E E R S I A I Y L G I G L C L L F I V R T L L L H P A I F G L H H I G M QM R I A M F S L I Y K K T L K L S S R V L D K I S I G Q L V S L L S N N L N K F D E G L A L A H F V W I A P L Q V A L L M G L I W E L L Q A S A F C G L G F L I V L A L F Male allele 2:
E W D R E L A S K K N R K L I N A L R R C F F W R F M F Y G I F L Y L G E V T K A V Q P L L L G R I I A S Y D P D N K E E R S I A I Y L G I G L C L L F I V R T L L L H P A I F D L H H I G M QM R I A M F S L I Y K K T L K L S S R V L D K I S I G Q L V S L L S N N L N K F D E G L A L A H F V W I A P L Q V A L L M G L I W E L L Q A S A F C G L G F L I V L A L F Female allele 1:
E W D R E L A S K K N P K L I N A L R R C F F W R F M F Y G I F L Y L G E V T K A V Q P L Stop L G R I I A S Y D P D N K E E R S I A I Y L G I G L C L L F I V R T L L L H P A I F G L H H I G MQ M R I A M F S L I Y K K T L K L S S R V L D K I S I G Q L V S L H S N N L N K F D E G L A L A H F V W I A P L Q V A L L M G L I W E L L Q A S A F C G L G F L I V L A L F E W D R E L A S K K N P K L I N A L R R C F F W R F M F Y G I F L Y L G E V T K A V Q P L L L G R I I A S Y D P D N K E E R S I A I Y L G I G L C L L F I V R T L L L H P A I F G L H H I G M QM R I A M F S L I Y K K T L K L S S R V L D K I S I G Q L V S L L S N N L N K F D E G L A L A H F V W I A P L Q V A L L M G L I W E L L Q A S A F C G L G F L I V L A L F Son allele 1:
E W D R E L A S K K N R K L I N A L R R C F F W R F M F Y G I F L Y L G E V T K A V Q P L L L G R I I A S Y D P D N K E E R S I A I Y L G I G L C L L F I V R T L L L H P A I F D L H H I G M QM R I A M F S L I Y K K T L K L S S R V L D K I S I G Q L V S L L S N N L N K F D E G L A L A H F V W I A P L Q V A L L M G L I W E L L Q A S A F C G L G F L I V L A L F Son allele 2:
E W D R E L A S K K N P K L I N A L R R C F F W R F M F Y G I F L Y L G E V T K A V Q P L Stop L G R I I A S Y D P D N K E E R S I A I Y L G I G L C L L F I V R T L L L H P A I F G L H H I G MQ M R I A M F S L I Y K K T L K L S S R V L D K I S I G Q L V S L H S N N L N K F D E G L A L A H F V W I A P L Q V A L L M G L I W E L L Q A S A F C G L G F L I V L A L F Database:
E W D R E L A S K K N P K L I N A L R R C F F W R F M F Y G I F L Y L G E V T K A V Q P L L L G R I I A S Y D P D N K E E R S I A I Y L G I G L C L L F I V R T L L L H P A I F G L H H I G M QM R I A M F S L I Y K K T L K L S S R V L D K I S I G Q L V S L L S N N L N K F D E G L A L A H F V W I A P L Q V A L L M G L I W E L L Q A S A F C G L G F L I V L A L F Fig7

Fig 8
Figure 9
Figure 10
TASK6
When I observed the given family sequences, father has more symptoms compare to wife and son (fig.1).he was suffering with that cholera severely which was already identified by symptoms. And some mutations are occurs in their sequences such as silent mutations and missense mutations (fig.5).mainly protein is not working good so father has extra symptoms. And son losses his weight.
There is a connection between cholera and CFTR.Cystic fibrosis (CF) is the most widely recognized lethal hereditary infection among white Americans. CF is an issue caused by a transformation in a in a quality for a chloride channel called CFTR (cystic fibrosis transmembrane controller).A Transformation in both of the CFTR qualities (everybody has two duplicates of every quality) brings about the clinical illness known as cystic fibrosis. The outcome is thick discharges particularly in the lungs, bringing about pneumonia, and in the pancreas, bringing about diabetes and malabsorption (unfit to process sustenance). Despite the fact that the principle issues in cystic fibrosis patients are with the lungs and pancreas, the faulty particle direct is in cells everywhere throughout the body, which is the place cholera, comes in… Microscopic organisms called Vibrio cholera secretes a poison that ties to the CFTR channel, making it transform on and emit chloride into the digestive tract. Water then follows the chloride out of the cells (dispersion), and furthermore water cannot be ingested from the digestive system into the cells in view of the considerable number of particles inside the digestive system. The outcome is up to 1 liter of watery looseness of the bowels every hour, which can lead rapidly to death if oral rehydration treatment is not started rapidly. Generally, cholera has murdered considerable number individuals. Here is the place the two sicknesses meet up: if the CFTR channel has a deformity because of a transformation in its quality, the cholera poison can’t tie to the channel. Having a transformation in your CFTR is just valuable, nevertheless, in the event that you just have one changed quality (heterozygous). At that point, you are shielded from an intense instance of cholera, and rather will have a milder case. On the off chance that both of your CFTR qualities are changed (homozygous), at that point you will have an intense instance of cystic fibrosis. Verifiably, individuals with CF kicked the bucket as kids, so this insurance against cholera was inconsequential for a man homozygous for the changed quality, however exceptionally critical for the heterozygous individual. Numerous researchers trust that cholera plagues have chosen for those with one CFTR transformation. As it were, because the transformation gives leeway to the individuals who have it, they lived while other individuals kicked the bucket, so the changed quality kept on being passed along. There are three bits of proof that help this hypothesis: 1) there are a wide range of imperfections in the CFTR quality 2) the transformed quality has a high recurrence in the populace 3) and the exceptionally seniority of the transformation (researchers gauge that it is 50,000 years of age) (Bertrand petit, J. “Ciba Found Sump.” 1996. v. 197.p.97-114). These focuses all help the hypothesis that cholera has chosen for a changed CFTR, in light of the fact that if these transformations were just destructive and not supportive, such a large number of various transformations would not exist in a similar particle channel for such huge numbers of years in such a large number of various individual.
Cholera shows affection ion channels:
The cholera microscopic organisms deliver a poison that is made of six protein subunits. The cholera poison ties to receptors on cells in the mass of the small digestive system and enacts cyclic AMP (cyclic adenosine monophosphate, a courier atom), expanding the quantity of cyclic AMP particles in the cell. As CFTR channels are enacted by cyclic AMP, the expanded grouping of cyclic AMP causes the CFTR channels to open and remain open. This implies chloride particles (Cl–) move out of the cell into the lumen (within the small digestive tract tube). Sodium particles (Na+) are pulled in to the negative chloride particles, so they additionally leave the cell. With more particles in the lumen, the lumen has a lower water potential. This influences water to leave the cells coating the lumen by osmosis, down the focus angle. The cells lose a great deal of water, which causes serious lack of hydration, and the expanded water in the small digestive tract causes watery looseness of the bowels and heaving.

AATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGG
TCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAG
GTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACCAGACCAATTTTGAGGAAA
GGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTAT
CTGAAAAATTGGAAAGAGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCT
TCGGCGATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCA
GTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAACGCTCTATCG
CGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACACCCAGCCATTTT
TGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAGACTTTAAAG
CTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACA
AATTTGATGAAGGACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGG
GCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTT
CAGGCTGGGCTAGGGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTG
TGATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAA
AATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAAT
AGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAG
GAATCATCCTCCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCA
ATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAA
AAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCT
TCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAA
TGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTC
AAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGG
TGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCA
GTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGA
TACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAG
TTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGAGCAGTATA
CAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATA
TTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCTAAAATGGAACATT
TAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACT
CCAAAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAA
AGAAGAAATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGA
CAGAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAA
TCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATGAATGGCATCGAAGAG
GATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACTGC
CTCGCATCAGCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGAT
GACACACTCAGTTAACCAAGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTG
GCCCCTCAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAA
TAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGT
GACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGC
TTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAACACTCCTCTTC
AAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTA
TTATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCA
CTGGTGCATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCAC
CTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTT
GGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATTGTGATTGGAGCTATAGCA
GTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGA
GAGCATATTTCCTCCAAACCTCACAGCAACTCAAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCAC
TCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACT
CTGTTCCACAAAGCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCC
AAATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTAACAACAGG
AGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCT
GTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGACATGC
CAACAGAAGGTAAACCTACCAAGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGATTAT
TGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACA
GCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGG
TGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACAC
TGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTT
GGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGT
GGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGG
GAAGCTTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTG
GCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAA
CATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGTGAACACAG
GATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCC
ATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCCATCAGCCCCTCCGACAGGGTGAAGCTCT
TTCCCCACCGGAACTCAAGCAAGTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGA
AGAGGTGCAAGATACAAGGCTTTAGAGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGGAATTGG
AGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGA
TGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTGAT
AAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGT
TTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAA
TCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATC
ATACTTCTTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCT
TTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCTCAT
TTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCT
AGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAA
ATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGG
ACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGA
CCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCACA
GAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGACACACATGAAGTCCAA
GCATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTATGTACTTCATGCTGTCTACACT
AAGAGAGAATGAGAGACACACTGAAGAAGCACCAATCATGAATTAGTTTTATATGCTTCTGTTTTATAAT
TTTGTGAAGCAAAATTTTTTCTCTAGGAAATATTTATTTTAATAATGTTTCAAACATATATAACAATGCT
GTATTTTAAAAGAATGATTATGAATTACATTTGTATAAAATAATTTTTATATTTGAAATATTGACTTTTT
ATGGCACTAGTATTTCTATGAAATATTATGTTAAAACTGGGACAGGGGAGAACCTAGGGTGATATTAACC
AGGGGCCATGAATCACCTTTTGGTCTGGAGGGAAGCCTTGGGGCTGATGCAGTTGTTGCCCACAGCTGTA
TGATTCCCAGCCAGCACAGCCTCTTAGATGCAGTTCTGAAGAAGATGGTACCACCAGTCTGACTGTTTCC
ATCAAGGGTACACTGCCTTCTCAACTCCAAACTGACTCTTAAGAAGACTGCATTATATTTATTACTGTAA
GAAAATATCACTTGTCAATAAAATCCATACATTTGTGTGAAA
Figue:11:
5’3′ Frame 1aattggaagcaaatgacatcacagcaggtcagagaaaaagggttgagcggcaggcaccca N W K Q M T S Q Q V R E K G L S G R H P
gagtagtaggtctttggcattaggagcttgagcccagacggccctagcagggaccccagc E – – V F G I R S L S P D G P S R D P S
gcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaacttttt A R E T M Q R S P L E K A S V V S K L F
ttcagctggaccagaccaattttgaggaaaggatacagacagcgcctggaattgtcagac F S W T R P I L R K G Y R Q R L E L S D
atataccaaatcccttctgttgattctgctgacaatctatctgaaaaattggaaagagaa I Y Q I P S V D S A D N L S E K L E R E
tgggatagagagctggcttcaaagaaaaatcctaaactcattaatgcccttcggcgatgt W D R E L A S K K N P K L I N A L R R C
tttttctggagatttatgttctatggaatctttttatatttaggggaagtcaccaaagca F F W R F M F Y G I F L Y L G E V T K A
gtacagcctctcttactgggaagaatcatagcttcctatgacccggataacaaggaggaa V Q P L L L G R I I A S Y D P D N K E E
cgctctatcgcgatttatctaggcataggcttatgccttctctttattgtgaggacactg R S I A I Y L G I G L C L L F I V R T L
ctcctacacccagccatttttggccttcatcacattggaatgcagatgagaatagctatg L L H P A I F G L H H I G M Q M R I A M
tttagtttgatttataagaagactttaaagctgtcaagccgtgttctagataaaataagt F S L I Y K K T L K L S S R V L D K I S
attggacaacttgttagtctcctttccaacaacctgaacaaatttgatgaaggacttgca I G Q L V S L L S N N L N K F D E G L A
ttggcacatttcgtgtggatcgctcctttgcaagtggcactcctcatggggctaatctgg L A H F V W I A P L Q V A L L M G L I W
gagttgttacaggcgtctgccttctgtggacttggtttcctgatagtccttgcccttttt E L L Q A S A F C G L G F L I V L A L F
caggctgggctagggagaatgatgatgaagtacagagatcagagagctgggaagatcagt Q A G L G R M M M K Y R D Q R A G K I S
gaaagacttgtgattacctcagaaatgattgaaaatatccaatctgttaaggcatactgc E R L V I T S E M I E N I Q S V K A Y C
tgggaagaagcaatggaaaaaatgattgaaaacttaagacaaacagaactgaaactgact W E E A M E K M I E N L R Q T E L K L T
cggaaggcagcctatgtgagatacttcaatagctcagccttcttcttctcagggttcttt R K A A Y V R Y F N S S A F F F S G F F
gtggtgtttttatctgtgcttccctatgcactaatcaaaggaatcatcctccggaaaata V V F L S V L P Y A L I K G I I L R K I
ttcaccaccatctcattctgcattgttctgcgcatggcggtcactcggcaatttccctgg F T T I S F C I V L R M A V T R Q F P W
gctgtacaaacatggtatgactctcttggagcaataaacaaaatacaggatttcttacaa A V Q T W Y D S L G A I N K I Q D F L Q
aagcaagaatataagacattggaatataacttaacgactacagaagtagtgatggagaat K Q E Y K T L E Y N L T T T E V V M E N
gtaacagccttctgggaggagggatttggggaattatttgagaaagcaaaacaaaacaat V T A F W E E G F G E L F E K A K Q N N
aacaatagaaaaacttctaatggtgatgacagcctcttcttcagtaatttctcacttctt N N R K T S N G D D S L F F S N F S L L
ggtactcctgtcctgaaagatattaatttcaagatagaaagaggacagttgttggcggtt G T P V L K D I N F K I E R G Q L L A V
gctggatccactggagcaggcaagacttcacttctaatggtgattatgggagaactggag A G S T G A G K T S L L M V I M G E L E
ccttcagagggtaaaattaagcacagtggaagaatttcattctgttctcagttttcctgg P S E G K I K H S G R I S F C S Q F S W
attatgcctggcaccattaaagaaaatatcatctttggtgtttcctatgatgaatataga I M P G T I K E N I I F G V S Y D E Y R
tacagaagcgtcatcaaagcatgccaactagaagaggacatctccaagtttgcagagaaa Y R S V I K A C Q L E E D I S K F A E K
gacaatatagttcttggagaaggtggaatcacactgagtggaggtcaacgagcaagaatt D N I V L G E G G I T L S G G Q R A R I
tctttagcaagagcagtatacaaagatgctgatttgtatttattagactctccttttgga S L A R A V Y K D A D L Y L L D S P F G
tacctagatgttttaacagaaaaagaaatatttgaaagctgtgtctgtaaactgatggct Y L D V L T E K E I F E S C V C K L M A
aacaaaactaggattttggtcacttctaaaatggaacatttaaagaaagctgacaaaata N K T R I L V T S K M E H L K K A D K I
ttaattttgcatgaaggtagcagctatttttatgggacattttcagaactccaaaatcta L I L H E G S S Y F Y G T F S E L Q N L
cagccagactttagctcaaaactcatgggatgtgattctttcgaccaatttagtgcagaa Q P D F S S K L M G C D S F D Q F S A E
agaagaaattcaatcctaactgagaccttacaccgtttctcattagaaggagatgctcct R R N S I L T E T L H R F S L E G D A P
gtctcctggacagaaacaaaaaaacaatcttttaaacagactggagagtttggggaaaaa V S W T E T K K Q S F K Q T G E F G E K
aggaagaattctattctcaatccaatcaactctatacgaaaattttccattgtgcaaaag R K N S I L N P I N S I R K F S I V Q K
actcccttacaaatgaatggcatcgaagaggattctgatgagcctttagagagaaggctg T P L Q M N G I E E D S D E P L E R R L
tccttagtaccagattctgagcagggagaggcgatactgcctcgcatcagcgtgatcagc S L V P D S E Q G E A I L P R I S V I S
actggccccacgcttcaggcacgaaggaggcagtctgtcctgaacctgatgacacactca T G P T L Q A R R R Q S V L N L M T H S
gttaaccaaggtcagaacattcaccgaaagacaacagcatccacacgaaaagtgtcactg V N Q G Q N I H R K T T A S T R K V S L
gcccctcaggcaaacttgactgaactggatatatattcaagaaggttatctcaagaaact A P Q A N L T E L D I Y S R R L S Q E T
ggcttggaaataagtgaagaaattaacgaagaagacttaaaggagtgcttttttgatgat G L E I S E E I N E E D L K E C F F D D
atggagagcataccagcagtgactacatggaacacataccttcgatatattactgtccac M E S I P A V T T W N T Y L R Y I T V H
aagagcttaatttttgtgctaatttggtgcttagtaatttttctggcagaggtggctgct K S L I F V L I W C L V I F L A E V A A
tctttggttgtgctgtggctccttggaaacactcctcttcaagacaaagggaatagtact S L V V L W L L G N T P L Q D K G N S T
catagtagaaataacagctatgcagtgattatcaccagcaccagttcgtattatgtgttt H S R N N S Y A V I I T S T S S Y Y V F
tacatttacgtgggagtagccgacactttgcttgctatgggattcttcagaggtctacca Y I Y V G V A D T L L A M G F F R G L P
ctggtgcatactctaatcacagtgtcgaaaattttacaccacaaaatgttacattctgtt L V H T L I T V S K I L H H K M L H S V
cttcaagcacctatgtcaaccctcaacacgttgaaagcaggtgggattcttaatagattc L Q A P M S T L N T L K A G G I L N R F
tccaaagatatagcaattttggatgaccttctgcctcttaccatatttgacttcatccag S K D I A I L D D L L P L T I F D F I Q
ttgttattaattgtgattggagctatagcagttgtcgcagttttacaaccctacatcttt L L L I V I G A I A V V A V L Q P Y I F
gttgcaacagtgccagtgatagtggcttttattatgttgagagcatatttcctccaaacc V A T V P V I V A F I M L R A Y F L Q T
tcacagcaactcaaacaactggaatctgaaggcaggagtccaattttcactcatcttgtt S Q Q L K Q L E S E G R S P I F T H L V
acaagcttaaaaggactatggacacttcgtgccttcggacggcagccttactttgaaact T S L K G L W T L R A F G R Q P Y F E T
ctgttccacaaagctctgaatttacatactgccaactggttcttgtacctgtcaacactg L F H K A L N L H T A N W F L Y L S T L
cgctggttccaaatgagaatagaaatgatttttgtcatcttcttcattgctgttaccttc R W F Q M R I E M I F V I F F I A V T F
atttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagcc I S I L T T G E G E G R V G I I L T L A
atgaatatcatgagtacattgcagtgggctgtaaactccagcatagatgtggatagcttg M N I M S T L Q W A V N S S I D V D S L
atgcgatctgtgagccgagtctttaagttcattgacatgccaacagaaggtaaacctacc M R S V S R V F K F I D M P T E G K P T
aagtcaaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattca K S T K P Y K N G Q L S K V M I I E N S
cacgtgaagaaagatgacatctggccctcagggggccaaatgactgtcaaagatctcaca H V K K D D I W P S G G Q M T V K D L T
gcaaaatacacagaaggtggaaatgccatattagagaacatttccttctcaataagtcct A K Y T E G G N A I L E N I S F S I S P
ggccagagggtgggcctcttgggaagaactggatcagggaagagtactttgttatcagct G Q R V G L L G R T G S G K S T L L S A
tttttgagactactgaacactgaaggagaaatccagatcgatggtgtgtcttgggattca F L R L L N T E G E I Q I D G V S W D S
ataactttgcaacagtggaggaaagcctttggagtgataccacagaaagtatttattttt I T L Q Q W R K A F G V I P Q K V F I F
tctggaacatttagaaaaaacttggatccctatgaacagtggagtgatcaagaaatatgg S G T F R K N L D P Y E Q W S D Q E I W
aaagttgcagatgaggttgggctcagatctgtgatagaacagtttcctgggaagcttgac K V A D E V G L R S V I E Q F P G K L D
tttgtccttgtggatgggggctgtgtcctaagccatggccacaagcagttgatgtgcttg F V L V D G G C V L S H G H K Q L M C L
gctagatctgttctcagtaaggcgaagatcttgctgcttgatgaacccagtgctcatttg A R S V L S K A K I L L L D E P S A H L
gatccagtaacataccaaataattagaagaactctaaaacaagcatttgctgattgcaca D P V T Y Q I I R R T L K Q A F A D C T
gtaattctctgtgaacacaggatagaagcaatgctggaatgccaacaatttttggtcata
V I L C E H R I E A M L E C Q Q F L V I
gaagagaacaaagtgcggcagtacgattccatccagaaactgctgaacgagaggagcctc E E N K V R Q Y D S I Q K L L N E R S L
ttccggcaagccatcagcccctccgacagggtgaagctctttccccaccggaactcaagc F R Q A I S P S D R V K L F P H R N S S
aagtgcaagtctaagccccagattgctgctctgaaagaggagacagaagaagaggtgcaa K C K S K P Q I A A L K E E T E E E V Q
gatacaaggctttagagagcagcataaatgttgacatgggacatttgctcatggaattgg D T R L – R A A
Figure:12
5’3′ Frame 1aattggaagcaaatgacatcacagcaggtcagagaaaaagggttgagcggcaggcacccagagtagtaggtctttggcattaggagcttgagcccagacggccctagcagggaccccagcgcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaactttttttcagctggaccagaccaattttgaggaaaggatacagacagcgcctggaattgtcagacatataccaaatcccttctgttgattctgctgacaatctatctgaaaaattggaaagagaatgggatagagagctggcttcaaagaaaaatcctaaactcattaatgcccttcggcgatgttttttctggagatttatgttctatggaatctttttatatttaggggaagtcaccaaagcagtacagcctctcttactgggaagaatcatagcttcctatgacccggataacaaggaggaacgctctatcgcgatttatctaggcataggcttatgccttctctttattgtgaggacactgctcctacacccagccatttttggccttcatcacattggaatgcagatgagaatagctatgtttagtttgatttataagaagactttaaagctgtcaagccgtgttctagataaaataagtattggacaacttgttagtctcctttccaacaacctgaacaaatttgatgaaggacttgcattggcacatttcgtgtggatcgctcctttgcaagtggcactcctcatggggctaatctgggagttgttacaggcgtctgccttctgtggacttggtttcctgatagtccttgccctttttcaggctgggctagggagaatgatgatgaagtacagagatcagagagctgggaagatcagtgaaagacttgtgattacctcagaaatgattgaaaatatccaatctgttaaggcatactgctgggaagaagcaatggaaaaaatgattgaaaacttaagacaaacagaactgaaactgactcggaaggcagcctatgtgagatacttcaatagctcagccttcttcttctcagggttctttgtggtgtttttatctgtgcttccctatgcactaatcaaaggaatcatcctccggaaaatattcaccaccatctcattctgcattgttctgcgcatggcggtcactcggcaatttccctgggctgtacaaacatggtatgactctcttggagcaataaacaaaatacaggatttcttacaaaagcaagaatataagacattggaatataacttaacgactacagaagtagtgatggagaatgtaacagccttctgggaggagggatttggggaattatttgagaaagcaaaacaaaacaataacaatagaaaaacttctaatggtgatgacagcctcttcttcagtaatttctcacttcttggtactcctgtcctgaaagatattaatttcaagatagaaagaggacagttgttggcggttgctggatccactggagcaggcaagacttcacttctaatggtgattatgggagaactggagccttcagagggtaaaattaagcacagtggaagaatttcattctgttctcagttttcctggattatgcctggcaccattaaagaaaatatcatctttggtgtttcctatgatgaatatagatacagaagcgtcatcaaagcatgccaactagaagaggacatctccaagtttgcagagaaagacaatatagttcttggagaaggtggaatcacactgagtggaggtcaacgagcaagaatttctttagcaagagcagtatacaaagatgctgatttgtatttattagactctccttttggatacctagatgttttaacagaaaaagaaatatttgaaagctgtgtctgtaaactgatggctaacaaaactaggattttggtcacttctaaaatggaacatttaaagaaagctgacaaaatattaattttgcatgaaggtagcagctatttttatgggacattttcagaactccaaaatctacagccagactttagctcaaaactcatgggatgtgattctttcgaccaatttagtgcagaaagaagaaattcaatcctaactgagaccttacaccgtttctcattagaaggagatgctcctgtctcctggacagaaacaaaaaaacaatcttttaaacagactggagagtttggggaaaaaaggaagaattctattctcaatccaatcaactctatacgaaaattttccattgtgcaaaagactcccttacaaatgaatggcatcgaagaggattctgatgagcctttagagagaaggctgtccttagtaccagattctgagcagggagaggcgatactgcctcgcatcagcgtgatcagcactggccccacgcttcaggcacgaaggaggcagtctgtcctgaacctgatgacacactcagttaaccaaggtcagaacattcaccgaaagacaacagcatccacacgaaaagtgtcactggcccctcaggcaaacttgactgaactggatatatattcaagaaggttatctcaagaaactggcttggaaataagtgaagaaattaacgaagaagacttaaaggagtgcttttttgatgatatggagagcataccagcagtgactacatggaacacataccttcgatatattactgtccacaagagcttaatttttgtgctaatttggtgcttagtaatttttctggcagaggtggctgcttctttggttgtgctgtggctccttggaaacactcctcttcaagacaaagggaatagtactcatagtagaaataacagctatgcagtgattatcaccagcaccagttcgtattatgtgttttacatttacgtgggagtagccgacactttgcttgctatgggattcttcagaggtctaccactggtgcatactctaatcacagtgtcgaaaattttacaccacaaaatgttacattctgttcttcaagcacctatgtcaaccctcaacacgttgaaagcaggtgggattcttaatagattctccaaagatatagcaattttggatgaccttctgcctcttaccatatttgacttcatccagttgttattaattgtgattggagctatagcagttgtcgcagttttacaaccctacatctttgttgcaacagtgccagtgatagtggcttttattatgttgagagcatatttcctccaaacctcacagcaactcaaacaactggaatctgaaggcaggagtccaattttcactcatcttgttacaagcttaaaaggactatggacacttcgtgccttcggacggcagccttactttgaaactctgttccacaaagctctgaatttacatactgccaactggttcttgtacctgtcaacactgcgctggttccaaatgagaatagaaatgatttttgtcatcttcttcattgctgttaccttcatttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagccatgaatatcatgagtacattgcagtgggctgtaaactccagcatagatgtggatagcttgatgcgatctgtgagccgagtctttaagttcattgacatgccaacagaaggtaaacctaccaagtcaaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattcacacgtgaagaaagatgacatctggccctcagggggccaaatgactgtcaaagatctcacagcaaaatacacagaaggtggaaatgccatattagagaacatttccttctcaataagtcctggccagagggtgggcctcttgggaagaactggatcagggaagagtactttgttatcagcttttttgagactactgaacactgaaggagaaatccagatcgatggtgtgtcttgggattcaataactttgcaacagtggaggaaagcctttggagtgataccacagaaagtatttattttttctggaacatttagaaaaaacttggatccctatgaacagtggagtgatcaagaaatatggaaagttgcagatgaggttgggctcagatctgtgatagaacagtttcctgggaagcttgactttgtccttgtggatgggggctgtgtcctaagccatggccacaagcagttgatgtgcttggctagatctgttctcagtaaggcgaagatcttgctgcttgatgaacccagtgctcatttggatccagtaacataccaaataattagaagaactctaaaacaagcatttgctgattgcacagtaattctctgtgaacacaggatagaagcaatgctggaatgccaacaatttttggtcatagaagagaacaaagtgcggcagtacgattccatccagaaactgctgaacgagaggagcctcttccggcaagccatcagcccctccgacagggtgaagctctttccccaccggaactcaagcaagtgcaagtctaagccccagattgctgctctgaaagaggagacagaagaagaggtgcaagatacaaggctttagagagcagcataaatgttgacatgggacatttgctcatggaattgg
figure:13
left36598400
figure;14
Just bio
AATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTAGGGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGAGCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACAGAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTCAAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTAACAACAGGAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCAAGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCCATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTTTAGAGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGTTACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGACACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTATGTACTTCATGCTGTCTACACTAAGAGAGAATGAGAGACACACTGAAGAAGCACCAATCATGAATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCAAAATTTTTTCTCTAGGAAATATTTATTTTAATAATGTTTCAAACATATATAACAATGCTGTATTTTAAAAGAATGATTATGAATTACATTTGTATAAAATAATTTTTATATTTGAAATATTGACTTTTTATGGCACTAGTATTTCTATGAAATATTATGTTAAAACTGGGACAGGGGAGAACCTAGGGTGATATTAACCAGGGGCCATGAATCACCTTTTGGTCTGGAGGGAAGCCTTGGGGCTGATGCAGTTGTTGCCCACAGCTGTATGATTCCCAGCCAGCACAGCCTCTTAGATGCAGTTCTGAAGAAGATGGTACCACCAGTCTGACTGTTTCCATCAAGGGTACACTGCCTTCTCAACTCCAAACTGACTCTTAAGAAGACTGCATTATATTTATTACTGTAAGAAAATATCACTTGTCAATAAAATCCATACATTTGTGTGAAA
FIGURE:15NcoI
Figure:17XhoI
Figure:181). A clone is a gathering of hereditarily indistinguishable cells got from a solitary cell. In exacting sense, gene cloning intends to make numerous precise of the quality. A quality is an extend of DNA which codes for a capacity e.g. a quality for rRNA or a protein, for example, insulin. It incorporates the coding sequence and its administrative components i.e. promoter, administrator and so forth. Quality cloning can be accomplished by two different methodologies: (1) cell based and (2) polymerase chain response (PCR).

Post Author: admin